circad | circRNAs associated with diseases

Circ-ATP8A2
Gene	ATP8A2	Organism	Human
Genome Locus		Build	hg19
Disease	Cervical Cancer	ICD-10	Malignant neoplasm of cervix uteri (C53)
DBLink		PMID	31029604
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Tissues from 46 patients with CC who underwent surgery
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCAGCA TTGCCGGAGTAA Reverse AGTCATAGAGGTGGCGGTTG	Statistics	Fold Change : Upregulated pvalue : <0.06
Citation
Ding, L, Zhang, H (2019). Circ-ATP8A2 promotes cell proliferation and invasion as a ceRNA to target EGFR by sponging miR-433 in cervical cancer. Gene, 705:103-108.